rs13197557 chr6:104325874 A>G
- Sequence
ggagattcttcaggcactccttcc[A/G]ttatttaataatctttgccgcaaa
- ASB in cell types
- H929 (plasma cell myeloma) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -1.81 | 2.19 | 1.00 | |||
| gastroesophageal sphincter | -0.65 | 1.63 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), ldl cholesterol, salmonella-induced pyroptosis, suicide attempts in major depressive disorder