rs13200457 chr6:85323658 A>T
- Sequence
gcaggctaagcttttacaaggtgg[A/T]agtctgagtatgaatccctttgat
- ASB in cell types
- foreskin keratinocyte erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.89 | n/a | 2.17 | |||
| erythroid progenitors | 2.71 | -1.91 | 2.00 |
Items per page:
1 – 2 of 2