rs13200515 chr6:22737530 A>C
- Sequence
ggaatccttgctcactgtttcttc[A/C]gggtacaaggatgggttcgactgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) foreskin keratinocyte GM10847 (female B-cells Lymphoblastoid Cell Lines) testis
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -4.09 | 4.13 | 1.00 | 6.14 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
