rs13207230 chr6:7041467 G>A
- Sequence
ctatgaggagccaaggaaaggttg[G/A]ggagtctgaagagagaaggacctg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.78 | 0.48 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, cystatin c in serum, eye color, infant head circumference, irritible bowel syndrome, ldl cholesterol, neuroblastoma (brain cancer), serum urate, tetrology of fallot, waist hip ratio