rs13207432 chr6:52589296 T>G
- Sequence
gcaaagggagcaaattccatagat[T/G]cctctgcccctaagtctcaaagtg
- ASB in cell types
- HepG2 (hepatoblastoma) HKC8 (kidney proximal tubule cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.82 | 0.36 | 2.00 | |||
| HKC8 (kidney proximal tubule cell line) | 1.45 | -1.10 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, alzheimers disease, infant head circumference, ldl cholesterol, refractive error, total cholesterol