rs13208297 chr6:150419149 G>A
- Sequence
gaaaatagtggaagacacttagga[G/A]ggagaagagagaaatgaaatttat
- ASB in cell types
- foreskin keratinocyte FT282 (normal human fallopian tube tissue) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.57 | -1.78 | 1.50 | |||
| FT282 (normal human fallopian tube tissue) | 1.87 | -0.80 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.31 | 0.67 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, comorbid depressive syndrome and alcohol dependence, late onset alzheimers disease, parkinsons disease