rs13208357 chr6:93679742 C>T
- Sequence
gctatgatgacatagaagagagca[C/T]tacccagattagaaaagtcaggta
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -1.38 | 1.38 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence, alcohol dependence (early age of onset), alcohol dependence without depressive symptoms, comorbid depressive syndrome and alcohol dependence, depression scale of the revised neo personality inventory, diastolic blood pressure (dbp), hip bone mineral density (bmd), neuroblastoma (brain cancer), rheumatoid arthritis, triglycerides