rs13213508 chr6:6152322 G>A
- Sequence
gataggcatcaagtttcctgctgg[G/A]acaaaggggattcctgagtttaag
- ASB in cell types
- hMADS-3 (adipose-derived stem cells)
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 1.81 | -0.87 | 1.50 | -2.74 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, asthma, hdl cholesterol change with statins, ldl cholesterol, total cholesterol