rs13214158 chr6:47478510 T>G
- Sequence
cctgttcaccagaaaggtgcggga[T/G]ggggggcgggggcgcctggccacc
- ASB in cell types
- breast tumor MOLT-4 (Adult T acute lymphoblastic leukemia) T-cells
- ASB for transcription factors
- ESR1_HUMAN RAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.35 | -1.58 | 2.00 | n/a | No Hit | |||
| RAG2_HUMAN | 2.17 | -1.74 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis