rs13217599 chr6:27618451 T>C
- Sequence
cctaacagactgccctttgggttc[T/C]ggtgtttacctacacttcttgtgt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.87 | 0.58 | 2.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol change with statins, height, ldl cholesterol, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid