rs13218191 chr6:170605988 A>G
- Sequence
taacactaaaaggtgaagcagagg[A/G]catgaaaactcactctgtgcatcc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC2_HUMAN IKZF1_HUMAN ZN316_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC2_HUMAN | 2.56 | -1.46 | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | 2.48 | -0.95 | 1.00 | n/a | n/a | |||
| ZN316_HUMAN | 2.23 | -1.59 | 1.00 | n/a | No Hit | |||
| REQU_HUMAN | 2.51 | -2.35 | 1.00 | n/a | n/a | |||
| KDM1A_HUMAN | 1.83 | -1.08 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood