rs13222837 chr7:129098910 A>T
- Sequence
catgttggcaacaatttgcaaggt[A/T]gactagttagttactcatgcacat
- ASB in cell types
- CRC107 (colorectal cancer metastatic stem cells) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- REST_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | -0.28 | 2.76 | 1.50 | n/a | No Hit | |||
| STAG1_HUMAN | n/a | 2.40 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Liver, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood