rs13223746 chr7:3673562 T>G
- Sequence
cggcctgttattacatgagtttat[T/G]aacattcactgtgagatgccttgg
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.58 | -1.50 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.91 | -1.57 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, age at death with kuru exposure, chronic kidney disease, major depressive disorder (citalopram treatment response (% change in qids-sr from baseline)), neuroblastoma (brain cancer), primary rhegmatogenous retinal detachment, schizophrenia, systolic blood pressure (sbp)