rs13223819 chr7:106462764 C>T
- Sequence
tattcaaagggtgttttgtgattt[C/T]ccaaaaactcaaaaaataacgagg
- ASB in cell types
- K562 (myelogenous leukemia) tibial artery Peyer's patch H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.73 | 0.03 | 1.46 | |||
| tibial artery | 2.62 | -2.34 | 1.00 | |||
| Peyer's patch | -1.90 | 2.29 | 1.00 | |||
| H929 (plasma cell myeloma) | -1.85 | 2.15 | 1.00 |
Items per page:
1 – 4 of 4