rs13223952 chr7:25856998 G>C
- Sequence
cttcgctgcctcaaccctgagaga[G/C]acacacacacacacacacacacac
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.72 | 1.75 | 1.25 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.51 | 1.27 | 1.20 |
Items per page:
1 – 2 of 2