rs13224990 chr7:2709931 G>A
- Sequence
cgcacacaggctttgtcaactgcc[G/A]ggttccaggcagtgcagagccctg
- ASB in cell types
- erythroid cells glioblastoma patient-derived cell model epidermal keratinocytes GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 3.61 | 3.00 | |||
| glioblastoma patient-derived cell model | -0.86 | 0.86 | 1.00 | |||
| epidermal keratinocytes | 2.24 | -1.58 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -3.84 | 2.04 | 1.50 | |||
| erythroid progenitors | 1.63 | -1.27 | 3.00 |
Items per page:
1 – 5 of 5