rs13225215 chr7:151087426 C>T
- Sequence
gtcgtgaccggggaggcttcttag[C/T]cgctgcccgggccctgctccgcag
- ASB in cell types
- K562 (myelogenous leukemia) pancreas
- ASB for transcription factors
- IKZF2_HUMAN RFOX2_HUMAN ZN687_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 0.83 | 2.45 | 1.00 | n/a | n/a | |||
| RFOX2_HUMAN | 1.74 | -1.23 | 1.75 | n/a | n/a | |||
| ZN687_HUMAN | 2.17 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood