rs13226670 chr7:90179198 A>C
- Sequence
tgggtttcacttcagtttttagat[A/C]cccagccctaacaattaagcaaaa
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma) HCT-116 (colon carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells) monocyte-derived dendritic cells
- ASB for transcription factors
- CEBPB_HUMAN TF65_HUMAN STAT1_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | n/a | 2.92 | 2.67 | n/a | No Hit | |||
| TF65_HUMAN | 0.46 | 1.57 | 1.38 | n/a | No Hit | |||
| STAT1_HUMAN | 2.13 | -1.40 | 2.00 | 2.56 | Discordant | |||
| FLI1_HUMAN | 2.15 | -1.95 | 1.00 | n/a | No Hit | |||
| FOSL1_HUMAN | 1.85 | -0.53 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood