rs13227878 chr7:55254963 A>C
- Sequence
aggcgcgacggcggcaccggcggg[A/C]tggagcagcgggatcccgcggtga
- ASB in cell types
- KB (cervical adenocarcinoma) COLO-829 (melanoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KB (cervical adenocarcinoma) | 1.62 | -0.05 | 2.00 | |||
| COLO-829 (melanoma) | 2.11 | -1.76 | 1.00 |
Items per page:
1 – 2 of 2