rs13228365 chr7:158707918 T>C
- Sequence
catgggcaggcctggaaaaagcac[T/C]acttgattggctgaaaggcatcaa
- ASB in cell types
- THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.25 | 1.33 | 1.43 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Nerve_Tibial, Pancreas, Pituitary, Stomach, Testis, Thyroid, Whole_Blood