rs13231773 chr7:98223997 G>A
- Sequence
ggcaggggtctccctggggaaggg[G/A]gtcgggcctccctggggctggagc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- GLIS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS1_HUMAN | -5.36 | 3.18 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Muscle_Skeletal, Whole_Blood