rs13231792 chr7:5439664 T>G
- Sequence
gccctccctgagctgaggcccccc[T/G]gcccctctccccgccatggatcca
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.07 | -0.02 | 1.14 |
Items per page:
1 – 1 of 1