rs13232648 chr7:17992618 C>A
- Sequence
agagacacggtttcatcgtgttgg[C/A]caggctggtcttgaactcccgaca
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.74 | -3.02 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid