rs13233873 chr7:98802874 A>C
- Sequence
gtggcctgagcccagcagagaaca[A/C]tcccacccccaggtcttcttgcag
- ASB for transcription factors
- KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | 2.31 | 0.63 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1