rs13236414 chr7:33156822 T>G
- Sequence
ttatgtcagaggcctgataaagtg[T/G]gctctcattgattttatggtaaag
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| JB6 (Human anaplastic large cell lymphoma) | -0.20 | 1.51 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als) (early age of onset), hdl cholesterol change with statins, infant head circumference, obesity with early age of onset (age >2), refractive error, triglycerides
GTEx eQTL Adipose_Subcutaneous, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid