rs13237350 chr7:155209409 A>T
- Sequence
ggaagccgagtcggctgtctgctg[A/T]cctggcagccatgcctgctggtgc
- ASB in cell types
- HKC8 (kidney proximal tubule cell line) EA.hy 926 (human umbilical vein endothelial cell line)
- ASB for transcription factors
- EPAS1_HUMAN E2F8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EPAS1_HUMAN | 1.05 | -0.43 | 1.00 | n/a | No Hit | |||
| E2F8_HUMAN | 2.15 | 0.23 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2