rs13239531 chr7:17706758 T>A
- Sequence
ttgtgattattagaatgccgggaa[T/A]gttcttgttcttttaggatgaaaa
- ASB in cell types
- foreskin keratinocyte GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.50 | n/a | 2.33 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -0.31 | 0.98 | 1.00 |
Items per page:
1 – 2 of 2