rs13247756 chr7:47852845 A>C
- Sequence
aggcaaagacttagcctgagcaca[A/C]gcagagccctaaggatcaggagga
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.28 | 0.79 | 1.05 | n/a | n/a |
Items per page:
1 – 1 of 1