rs13247788 chr7:53714450 T>A
- Sequence
aatctccctattttgttatctgta[T/A]ccttaaatacaccaaaatatccct
- ASB in cell types
- D341 Med (medulloblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| D341 Med (medulloblastoma) | 1.30 | 0.41 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), rheumatoid arthritis, urinary albumin-to-creatinine ratio, years of education