rs13249359 chr8:7091981 G>C
- Sequence
cccgcggaggagcccgcgccagcc[G/C]gatgcccagctccgcgccgcgcgg
- ASB in cell types
- spleen pancreas GM18526 (B – cells Lymphoblastoid Cell Lines) upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN CATA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.67 | -0.07 | 1.69 | n/a | No Hit | |||
| CATA_HUMAN | 2.86 | -5.08 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2