rs13249478 chr8:29804393 T>G
- Sequence
gtggctagagaagccagcaggaat[T/G]taaaaagacctaaggtactcacgt
- ASB in cell types
- neural cell
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | -1.33 | 1.60 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1