rs13250769 chr8:6932462 T>C
- Sequence
gtcctgaagcccaaggcaggaata[T/C]gtaggccctgggttaagctagtgg
- ASB in cell types
- U937 (adult acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| U937 (adult acute monocytic leukemia) | 2.71 | -1.91 | 2.00 |
Items per page:
1 – 1 of 1