rs13251663 chr8:140831478 A>G
- Sequence
catccgtaactgttaagttagctg[A/G]cgttataaacaaaaccagagacat
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -0.26 | 1.03 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 0.88 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), mean bilateral hippocampal volume, systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis