rs13252381 chr8:143740421 C>T
- Sequence
ccgaccggtgtcggccgctcaaac[C/T]ttcctccgggcccgataccgccct
- ASB in cell types
- HeLa (cervical adenocarcinoma) KB (cervical adenocarcinoma) SMMC-7721 (hepatocellular carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | 2.05 | 0.35 | 3.00 | |||
| KB (cervical adenocarcinoma) | 2.12 | -4.33 | 2.00 | |||
| SMMC-7721 (hepatocellular carcinoma) | 1.25 | -3.46 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid