rs13253287 chr8:95758848 C>T
- Sequence
taactgaaccctgacctctagtgg[C/T]gggaaagaattagcaagaagaaca
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.95 | n/a | 2.33 | |||
| A549 (lung carcinoma) | 0.84 | 0.15 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, acute lung injury following major trauma, body mass index (bmi), cystatin c in serum, lp-pla2 mass, simpson-angus scale, tardive dyskinesia, triglycerides