rs13254325 chr8:11553004 C>A
- Sequence
acacatgcaaacacatacacatgt[C/A]cacgcatgcacatatacacacaca
- ASB in cell types
- pancreas
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.12 | 2.72 | 1.37 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), ldl cholesterol change with statins, serum creatinine, total cholesterol change with statins, triglycerides