rs13257199 chr8:86785345 G>A
- Sequence
gaagttttctcatttctttttcag[G/A]ggcttgtggtctcttgcttcctct
- ASB in cell types
- THP-1 (acute monocytic leukemia) foreskin keratinocyte WA01 (H1, human embryonic stem cells) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.20 | 0.08 | 1.67 | n/a | n/a |
Items per page:
1 – 1 of 1