rs13259300 chr8:119070702 A>C
- Sequence
ctagtggtctcccttgaaaataac[A/C]gcgataaaatatgtacagctatta
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.19 | 0.57 | 1.48 | n/a | No Hit | |||
| STAG1_HUMAN | 2.19 | -1.02 | 1.90 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Lung, Skin_Sun_Exposed_Lower_leg