rs13259538 chr8:61810333 A>G
- Sequence
atctgaggtccggagtttgagacc[A/G]atttggccaacatggtgaaacccc
- ASB in cell types
- A549 (lung carcinoma) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.10 | 1.03 | 2.00 | |||
| H929 (plasma cell myeloma) | 1.59 | n/a | 2.00 |
Items per page:
1 – 2 of 2