rs13260700 chr8:18922852 G>C
- Sequence
aggatacagataaagggatgcatg[G/C]ggcaaggcatgtgggagggggcag
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.68 | -0.98 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, homa-b, ldl cholesterol change with statins