rs13263052 chr8:58388710 G>A
- Sequence
cactaaaagaacaaattaataatt[G/A]actgatatcttaggtgagtacatt
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.34 | -1.38 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg