rs13263909 chr8:51899198 C>T
- Sequence
gacgcccccatctggccccgcccc[C/T]ctcagggctcgctccgcccccaag
- ASB in cell types
- fetal bone marrow-derived mononuclear cells primary B-CLL cells Ishikawa (endometrial adenocarcinoma) endometrium
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fetal bone marrow-derived mononuclear cells | 2.54 | -4.49 | 1.50 | |||
| primary B-CLL cells | n/a | 2.08 | 3.00 | |||
| Ishikawa (endometrial adenocarcinoma) | 1.26 | 0.09 | 1.40 | |||
| endometrium | -0.68 | 2.68 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood