rs13266520 chr8:89574824 T>C
- Sequence
tcttcagtagaatttgtctttgtg[T/C]cttttgaccatttttgattaaatc
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.27 | 3.14 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.98 | 0.34 | 1.20 |
Items per page:
1 – 2 of 2