rs13273510 chr8:23695484 T>C
- Sequence
tcccttccgtgtgctcccatgcga[T/C]gtttataatgcacctcttctagtt
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.81 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting insulin, homa-ir, type 1 diabetes, gender differentiated, waist hip ratio