rs13278062 chr8:23225458 G>T
- Sequence
tttacggcctcctccgtcactacc[G/T]ggcgagtgattcagcctgcctttt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLM14 (Adult acute myeloid leukemia) renal cortex
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.19 | -1.71 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), age-related macular degeneration, exudative age-related macular degeneration, infant head circumference, polypoidal choroidal vasculopathy, typical age-related macular degeneration
PheWAS abdominal hernia, abnormal coagulation profile, abnormal function study of cardiovascular system, acute periodontitis, aneurysm of other specified artery, anxiety disorder, anxiety, phobic and dissociative disorders, arthropathy nos, atherosclerosis, bronchiectasis, bullous dermatoses, cancer of the digestive organs and peritoneum, chronic liver disease and cirrhosis, chronic pancreatitis, circumscribed scleroderma, conductive hearing loss, congenital anomalies of urinary system, cystic kidney disease, diaphragmatic hernia, diseases of nail, disorders of penis, disorders of sweat glands, disturbance of skin sensation, early complications of trauma or procedure, eating disorder, ectropion or entropion, gouty arthropathy, hereditary hemolytic anemias, herpes simplex, hydronephrosis, hyperosmolality and/or hypernatremia, ischemic heart disease, kidney replaced by transpant, liver replaced by transplant, macular degeneration, wet, megaloblastic anemia, nevus, non-neoplastic, nontoxic multinodular goiter, nontoxic nodular goiter, open wound of nose and sinus, open wounds of extremities, open wounds of head, neck, and trunk, other aneurysm, other arthropathies, other hemoglobinopathies, other open wound of head and face, other specified diseases of nail, other upper respiratory disease, pancreatic cancer, pernicious anemia, pernicious or b12 deficiency anemia, phobia, pituitary hyperfunction, pneumonia, primary angle-closure glaucoma, psoriasis, psoriasis & related disorders, psoriasis vulgaris, schizoid personality disorder, sebaceous cyst, secondary malignancy of lymph nodes, subarachnoid hemorrhage (injury), sulfonamides, symptoms affecting skin, torsion dystonia, vascular disorders of penis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Vagina, Whole_Blood