rs13292569 chr9:122005710 A>G
- Sequence
aaatcaaatgccctccagcaatat[A/G]acaacatgttcttcaaggaagaga
- ASB in cell types
- HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | -0.59 | 1.81 | 4.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Liver, Lung, Nerve_Tibial, Ovary, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid