rs13294577 chr9:31260173 G>T
- Sequence
agacatgacaaaagagagtgaaag[G/T]gtttttcagcaatggcaatagaag
- ASB in cell types
- Th1-cells
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | -3.25 | 3.42 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol, hdl cholesterol change with statins, tetrology of fallot