rs13295021 chr9:98508484 C>T
- Sequence
caaggcatcgcctcaccagggaag[C/T]gcaaggagtcagggaattcccttt
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.86 | -0.43 | 1.67 |
Items per page:
1 – 1 of 1