rs13299059 chr9:117160277 G>T
- Sequence
cacacaggatctaagttcctaggg[G/T]gcaggggtccagtcaaagggaggc
- ASB in cell types
- epithelial cell of prostate GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -1.91 | 2.30 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -1.44 | 1.83 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, hypertension (early onset hypertension)