rs13302854 chr9:114082631 C>A
- Sequence
tccagctaaggactccatacatag[C/A]tgcaactgcactaaggtgtgaact
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.25 | -0.79 | 2.00 |
Items per page:
1 – 1 of 1